BYTETOOLS

GC Content Calculator

Count A, C, G and T in a sequence to get GC content, AT content and the GC/AT ratio, plus primer melting temperature and a sliding-window GC profile.

53.33%
GC content
46.67%
AT content
30 nt
Length
64.4 °C
Tm (salt-adjusted)

Base composition

BaseCountPercent of A+C+G+T
A — adenine723.33%
C — cytosine723.33%
G — guanine930%
T — thymine (or U)723.33%
  • %GC = (G + C) ÷ (A + T + G + C) × 100 = (9 + 7) ÷ 30 × 100 = 53.333%
  • GC : AT ratio = 1.1429

Melting temperature

Wallace rule: 92 °C

Tm = 2(A+T) + 4(G+C)

Not applicable: the Wallace rule only holds for primers under about 14 nucleotides and badly overestimates longer ones.

Salt-adjusted: 64.35 °C

Tm = 64.9 + 41 × (G + C − 16.4) ÷ N

Applicable here. It assumes 50 mM monovalent salt and 50 nM primer.

GC profile — 20-base sliding window

0255075100130%GC

Window GC ranges from 50% to 65% across 11 sampled positions. Sharp peaks in a genomic sequence often mark CpG islands near a promoter.

Reverse complement

AGACTTCTCCTCAGGAGTCAGGTGCACCAT

GC content is identical on both strands, because every G pairs with a C — which is why a single %GC figure describes a whole duplex.

Both melting-temperature formulas are rules of thumb. The nearest-neighbour thermodynamic model used by primer-design software is more accurate because it accounts for stacking energies, the actual salt and primer concentrations, and any mismatches — expect these estimates to sit within a few degrees of it for well-behaved primers and to drift further for GC-rich or self-complementary ones.

What is the GC Content Calculator?

GC content is the percentage of bases that are guanine or cytosine: (G + C) divided by (A + T + G + C), times 100. It matters because G-C pairs have three hydrogen bonds to A-T's two, so GC-rich DNA melts at a higher temperature.

  • Per-base counts with percentages, and the GC to AT ratio
  • Wallace rule and salt-adjusted melting temperature, with the applicable one highlighted
  • Sliding-window GC profile chart drawn as scalable SVG
  • Reverse complement of the sequence, ready to copy
  • FASTA headers, whitespace and ambiguity codes handled automatically
  • Nothing uploaded — the sequence never leaves your browser

How to use the GC Content Calculator

  1. 1

    Paste a DNA or RNA sequence, in plain text or FASTA format.

  2. 2

    Read GC content, AT content, length and melting temperature in the stat row.

  3. 3

    Check the base composition table for exact A, C, G and T counts and percentages.

  4. 4

    Compare the two melting-temperature formulas and see which applies to your length.

  5. 5

    Adjust the sliding window size to change the resolution of the GC profile chart.

About the GC Content Calculator

The ByteTools GC Content Calculator counts every base in a pasted sequence and reports GC content, AT content, the GC to AT ratio and the length, with a per-base breakdown table. FASTA headers, position numbers and whitespace are stripped for you, and uracil is counted as thymine so RNA works as well as DNA.

Two melting-temperature estimates sit alongside the counts. The Wallace rule, 2 times A plus T plus 4 times G plus C, applies to primers under about 14 nucleotides; the salt-adjusted formula 64.9 plus 41 times G plus C minus 16.4, all over N, takes over for longer oligos. The page highlights whichever one applies to your sequence and explains why the other does not.

A sliding-window chart plots GC content along the sequence, which is how CpG islands near promoters show up as sharp peaks. Everything is computed in your browser with no network request, so unpublished sequences stay entirely on your machine.

Frequently asked questions

What is a good GC content for a PCR primer?

Most primer design guidelines aim for 40 to 60 percent GC. Below that the primer binds too weakly, above it the primer can bind non-specifically and is harder to melt apart, and a run of G or C at the 3-prime end helps the polymerase get started.

How do you calculate GC content?

Add the number of guanines and cytosines, divide by the total number of A, C, G and T bases, and multiply by 100. Ambiguous positions marked N are normally excluded from both the top and the bottom of that fraction, which is what this tool does.

Why does GC content affect melting temperature?

A guanine-cytosine pair is held by three hydrogen bonds while adenine-thymine has only two, so GC-rich DNA takes more energy to separate. That is why melting temperature formulas weight G and C more heavily than A and T.

Which melting temperature formula should I use?

The Wallace rule for primers shorter than about 14 nucleotides, and the salt-adjusted formula from 14 upwards. Both are rules of thumb; primer design software uses a nearest-neighbour thermodynamic model that also accounts for stacking energies and your actual salt and primer concentrations.

Is GC content the same on both strands?

Yes. Every G on one strand pairs with a C on the other, so the combined count is identical either way. That is why a single GC percentage describes a whole double-stranded region without needing to say which strand you measured.

Related tools